Genetic sequence information for scientists about the novel coronavirus 2012

Whole Genome Sequence – Added 18th February 2013

The England 2 Coronavirus (CoV) genome has been assembled using overlapping PCR fragments of between 0.5 and 1.5 kb. The final sequenced genome coverage was between 2 and 11 fold, and the material sequenced was directly from clinical material NOT from a virus isolate.

The genome of England 2 CoV has been annotated using the coding regions defined in the GenBank entry JX869059 (EMC 2012).

Download the sequence and coding regions

England2_CoV genome sequence (Text Document, 53 KB)

Phylogenetic Analysis indicated that England 2 CoV clustered with England1 CoV and the virus identified in the Netherlands (EMC 2012, JX869059). The level of similarity within this cluster of novel coronaviruses was greater than 99.6%.

Figure 1 Phylogenetic Analysis of Complete Coronavirus Genomes

  

For further information, or to comment on this information please contact Monica.Galiano@hpa.org.uk or Richard.Myers@hpa.org.uk. We welcome feedback.

This sequence is provided for public health purposes. It is made freely available without restrictions in the fastest way possible. Unless acknowledged in publications which use this data, the individual scientists who worked to develop it will not be recognised. Please consider this when you include this sequence in a publication/analysis. Reference to this sequence in publications should be described as England 2 Coronavirus sequence provided by the Health Protection Agency, UK.

Whole genome sequence – added 13 November 2012 

The England 1 Coronavirus genome (England1_CoV) was assembled using 80 overlapping PCR fragments of between 0.5-1.5 kb. Degenerate primers were designed against an alignment of EMC virus and bat coronavirus HKU4 & HKU5. The final sequenced genome coverage was between 2 and 11 fold, and the material sequenced was directly from clinical material NOT from a virus isolate.

The genome of England1_CoV has been annotated using the coding regions defined in the GenBank entry JX869059 (EMC 2012). England1_CoV has been submitted to GenBank and the accession number will be added to this document, when it is available.

Download the sequence and coding regions:

England1_CoV genome sequence (Text Document, 61 KB)

England1_CoV was highly similar to the coronavirus sequenced in the Netherlands (EMC 2012, JX869059). The level of sequence diversity between EMC and England1_CoV, coupled with the available epidemiological information may suggest two zoonotic infections rather than human to human transmission.

Phylogenetic analysis (figure 1) showed that the England1_CoV belonged to genotype 2c and indicated that the closest relatives were bat coronaviruses detected in Hong Kong.

Figure 1: phylogenetic analysis of England1_CoV

 

A phylogenetic analysis of complete coronavirus genomes (figure 2) showed that England1_CoV (red) and EMC 2012 (blue) are closely related and that these viruses form a distinct clade that is related to HKU4 and HKU5 bat coronaviruses. Generation of the whole genome also enabled analysis of different fragments of the polymerase gene. This analysis indicated that there was a bat coronavirus identified in the Netherlands in 2008 that was most closely related to the novel human viruses. However, HKU 4 and HKU5 are the most closely related viruses for which there is a complete genome available.

Figure 2: phylogenetic analysis of complete coronovirus genomes

For further information, or to comment on this information please contact Monica.Galiano@hpa.org.uk  or Richard.Myers@hpa.org.uk

Reference to this sequence in publications should be described as England 1 Coronavirus sequence provided by the Health Protection Agency.

Update of diagnostics for novel coronavirus - added 30 September 2012 

• Rapid progress has been made in the characterization of the novel coronavirus, and in the development of sensitive and specific diagnostic assays. A rapid communication paper on Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction has been published in Eurosurveillance: Corman VM, Eckerle I, Bleicker T, Zaki A, Landt O, Eschbach-Bludau M, van Boheemen S, Gopal R, Ballhause M, Bestebroer TM, Muth D, Müller MA, Drexler JF, Zambon M, Osterhaus AD, Fouchier RM, Drosten C. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction. Euro Surveill. 2012;17(39):pii=20285. 
• Genomic Analysis for a Newly Isolated Human Betacoronavirus Lineage 2C by van Boheemen,S., Zaki,A.M., Bestebroer,T.M., de Graaf,M., Victor,S., Osterhaus,A.D., Haagmans,B.L. and Fouchier,R.A. has been published in Genbank: Human betacoronavirus 2c EMC/2012, complete genome, 30,118 bp linear RNA, Accession: JX869059.1 GI: 407076736 [external link].
• The Institut fur Virologie at the Universitats Klinikum, Bonn, Germany, which has played a major role in developing and validating the assays and reagents has recommended a testing algorithm that starts with a screening PCR for coronaviruses and is followed by assays specific for the novel strain. This laboratory can also offer positive control material and a link to a source of reagents for the recommended assays [external link]. The assays published have been tested by HPA on the limited clinical material available, so at least a preliminary validation of utility in clinical material has been performed. More data on this will be published shortly.
• There are likely to be a number of commercial developments in the near future with kits becoming available.
• The sequence data that HPA has from the London case is based on direct genomic detection in clinical material obtained at the weekend. The HPA does not yet have a virus isolate, although clinical material is in tissue culture in an attempt to make virus isolates. The patient clinical material that HPA have does not react with the specific molecular detection assays that we have for OC23, 229E, NL63 or SARS.
• Work on developing serological tests suitable for clinical diagnosis and epidemiological studies is underway. The HPA welcomes offers of reagents or information which people believe may be useful in this situation.
• The WHO has updated its website with information on the novel coronavirus infection [external link] 

Phylogenetic tree - added 25 September 2012

Phylogenetic tree constructed with partial sequences from the polymerase gene (nsp12) of representative coronaviruses from different groups is displayed in the attached figure.

The sequence obtained at HPA has been tentatively named as London1_novel CoV 2012 (boxed in red). The HPA sequence data is based on direct detection from clinical material from the London case. HPA do not yet have a virus isolate. There will shortly be a GENBANK accession number for the sequence. The attached phylogenetic tree is considered preliminary, as is virus nomenclature, and liable to change as more information or a virus isolate becomes available.

 
 

Partial nucleotide sequence of the viral polymerase (nsp12)

>London1_novel_CoV_2012_nsp12(partial)
TATTAGTGCTAAGAATAGAGCTCGCACTGTTGCAGGCGTGTCCATACTTAGCACAATGAC
TAATCGCCAGTACCATCAGAAAATGCTTAAGTCCATGGCTGCAACTCGTGGAGCGACTTG
CGTCATTGGTACTACAAAGTTCTATGGTGGCTGGGATTTCATGCTTAAAACATTGTACAA
AGATGTTGATAATCCGCATCTTATGGGT

Fasta file of the partial sequence

• London1 novel CoV 2012 nsp12 (partial) (ZIP Archive, 330 byte)

 

Last reviewed: 21 February 2013